View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17082_high_57 (Length: 249)

Name: NF17082_high_57
Description: NF17082
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17082_high_57
NF17082_high_57
[»] chr1 (2 HSPs)
chr1 (4-104)||(44047814-44047914)
chr1 (104-177)||(44047715-44047788)


Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 4 - 104
Target Start/End: Complemental strand, 44047914 - 44047814
Alignment:
Q  4 tgcttcacctgtgattgatttatatgtgactccatctagtacattaagttcttcgcctaaaggatgaatctcctcaccaatatcactatcactttctagt 103  Q
    ||||||| || |||||  ||||| |||||||||||| | ||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||||||    
T  44047914 tgcttcatctatgatttgtttatctgtgactccatcaaatacattatgttcttcacctaagggatgaatctcctcaccaatatcactatcactttctagt 44047815  T
Q  104 a 104  Q
    |    
T  44047814 a 44047814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 177
Target Start/End: Complemental strand, 44047788 - 44047715
Alignment:
Q  104 atcatccgatggtttaaactttgatggagatgaagga-cactataggattttatcttggaagagttttgattgaa 177  Q
    |||||| ||||||||||||||||||||||||| |||| ||||| ||||||||||||| |||| ||||||||||||    
T  44047788 atcatctgatggtttaaactttgatggagatggaggatcactaaaggattttatctttgaag-gttttgattgaa 44047715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University