View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17072_low_31 (Length: 262)

Name: NF17072_low_31
Description: NF17072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17072_low_31
NF17072_low_31
[»] chr6 (1 HSPs)
chr6 (22-180)||(2227014-2227171)
[»] chr5 (1 HSPs)
chr5 (70-115)||(32881693-32881738)


Alignment Details
Target: chr6 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 22 - 180
Target Start/End: Complemental strand, 2227171 - 2227014
Alignment:
Q  22 agttatctttttaattacaaaaaattaacttcagatcaattattaggtaaagtgaaaattcaggtttggtgttagattaaatcaaagattaaaatcttaa 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  2227171 agttatctttttaattacaaaaaattaacttcagatcaattattaggtaaagtgaaaattcaggtttggtgttggattaaatcaaagattaaaatcttaa 2227072  T
Q  122 aaagcatgactttaatcattggtgagttaatccatttggttgtctttgagttcgcggta 180  Q
    |||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||    
T  2227071 aaagcatgacttgaatcattggtgagttaatccatttggttgtc-ttgagttcgtggta 2227014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 70 - 115
Target Start/End: Original strand, 32881693 - 32881738
Alignment:
Q  70 aaagtgaaaattcaggtttggtgttagattaaatcaaagattaaaa 115  Q
    |||||| ||||| | |||||||||| ||||||||||||||||||||    
T  32881693 aaagtggaaatttaagtttggtgttggattaaatcaaagattaaaa 32881738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University