View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17072_high_35 (Length: 242)

Name: NF17072_high_35
Description: NF17072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17072_high_35
NF17072_high_35
[»] chr1 (2 HSPs)
chr1 (18-135)||(26920484-26920601)
chr1 (187-231)||(26920659-26920703)


Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 18 - 135
Target Start/End: Original strand, 26920484 - 26920601
Alignment:
Q  18 ggatgaagaaaatggaggaaacccatgtttcattgaatgatgatgatgttgatttgtgtcagtgtcatgatgttggggagcataggaaacaacttgggaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26920484 ggatgaagaaaatggaggaaacccatgtttcattgaatgatgatgatgttgatttgtgtcagtgtcatgatgttggggagcataggaaacaacttgggaa 26920583  T
Q  118 tggtgcaattgatgagga 135  Q
    ||||||||||||||||||    
T  26920584 tggtgcaattgatgagga 26920601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 187 - 231
Target Start/End: Original strand, 26920659 - 26920703
Alignment:
Q  187 aaagggatattatcaactactcctaacaaaccagaaggagtgatg 231  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  26920659 aaagggatattatcaactactcctaacaaaccagaaggagtgatg 26920703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University