View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1706_low_29 (Length: 322)

Name: NF1706_low_29
Description: NF1706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1706_low_29
NF1706_low_29
[»] chr5 (1 HSPs)
chr5 (11-162)||(27715172-27715324)
[»] chr3 (2 HSPs)
chr3 (80-209)||(44753634-44753763)
chr3 (204-304)||(44753839-44753939)


Alignment Details
Target: chr5 (Bit Score: 129; Significance: 9e-67; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 11 - 162
Target Start/End: Complemental strand, 27715324 - 27715172
Alignment:
Q  11 caaaggaaggatcctcaatgtcaggaagacgagtggtgtggttcctgaattgata-ctgttagtttgtgcagtttttgtttgccggtgttttctgtcatg 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  27715324 caaaggaaggatcctcaatgtcaggaagacgagtggtgtggttcctgaattgatatctgttagtttgtgcagtttttgtttgccggtgttttctgtcatg 27715225  T
Q  110 cgtagtctgtcaagcgcttttgtcctggctgttttgagcataggaattcgggt 162  Q
    || ||||||| |||||||||||||||||||||||||||||| | |||||||||    
T  27715224 cgcagtctgtaaagcgcttttgtcctggctgttttgagcattgcaattcgggt 27715172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 80 - 209
Target Start/End: Original strand, 44753634 - 44753763
Alignment:
Q  80 agtttttgtttgccggtgttttctgtcatgcgtagtctgtcaagcgcttttgtcctggctgttttgagcataggaattcgggtaggcaaagctgttgtgt 179  Q
    ||||||||||| || |||||||| |||||| |||||||||||||||||||| || |||||||||||||||||| | |||||||||||||| || |  | |    
T  44753634 agtttttgtttaccagtgttttcggtcatgtgtagtctgtcaagcgcttttttcttggctgttttgagcatagcagttcgggtaggcaaaactttattat 44753733  T
Q  180 agggggtgttctgcgcaacattgaaggtgt 209  Q
    | |||||||||||||||||| | |||||||    
T  44753734 aaggggtgttctgcgcaacaataaaggtgt 44753763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 204 - 304
Target Start/End: Original strand, 44753839 - 44753939
Alignment:
Q  204 aggtgtctgagaagtgcactctgctgctgccccatggtcttggtgtatattttcttgatggaattatagcaggtctgcgttgcgttaaatgacacttgga 303  Q
    |||||| ||||||||||||||||||||||  |||||| |||||||||| |||||||| | | |||||||||| || ||||||  ||||| ||||||||||    
T  44753839 aggtgtttgagaagtgcactctgctgctgttccatggccttggtgtattttttcttgttcgcattatagcagatcagcgttggcttaaaggacacttgga 44753938  T
Q  304 t 304  Q
    |    
T  44753939 t 44753939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University