View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17065_low_27 (Length: 207)

Name: NF17065_low_27
Description: NF17065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17065_low_27
NF17065_low_27
[»] chr6 (1 HSPs)
chr6 (13-188)||(4931911-4932088)


Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 13 - 188
Target Start/End: Original strand, 4931911 - 4932088
Alignment:
Q  13 cagtatcataggatataagaccatatagctctcatgaaccataatcactcg--tccttcaatcaaagtcgtatgaatcgtctgatttccttaagagatat 110  Q
    ||||||| | |||||||||||||||||| |||||||||||||||||||| |  ||||||||||||||||||||||||||||||||| |||||||||||||    
T  4931911 cagtatcgttggatataagaccatatagttctcatgaaccataatcacttgagtccttcaatcaaagtcgtatgaatcgtctgattcccttaagagatat 4932010  T
Q  111 cctaaagtgggatatccctaatggattgattacggtgaatgcttacttgaccacgcatgcgatatgagatgtccttaa 188  Q
    ||||||||| ||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||    
T  4932011 cctaaagtgagatatccttaatggattgattacggtgaatgcttacttgaacccgcatgcgatatgagatgtccttaa 4932088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University