View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17063_low_57 (Length: 363)

Name: NF17063_low_57
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17063_low_57
NF17063_low_57
[»] chr4 (2 HSPs)
chr4 (35-126)||(189492-189583)
chr4 (185-280)||(189642-189737)
[»] chr1 (1 HSPs)
chr1 (317-349)||(47532961-47532993)


Alignment Details
Target: chr4 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 35 - 126
Target Start/End: Original strand, 189492 - 189583
Alignment:
Q  35 tatgtaattaggcccacgaacttccaattaaaataagtatatagttcttcacttcaaaaagtcgttataggtttaaagatatgtttttccac 126  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  189492 tatgtaattaggcccacgaacttccaattaaaataagtatatagttcttcacttcaaaaaatcgttataggtttaaagatatgtttttccac 189583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 185 - 280
Target Start/End: Original strand, 189642 - 189737
Alignment:
Q  185 gtagttattgtaaaattgttctgatatttctttttcaataagtatgtgatgagaagtttttctaaacaaataaacattcaatttagtctctaaaag 280  Q
    ||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||    
T  189642 gtagttattgtaaaattcttctaatatttctttttcaataagtatgtgatgagaagtttttctaaacaagtaaacactcaatttagtctctaaaag 189737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 317 - 349
Target Start/End: Original strand, 47532961 - 47532993
Alignment:
Q  317 taattgatctgccggtccattaagttatttttt 349  Q
    |||||||||||||||||| ||||||||||||||    
T  47532961 taattgatctgccggtcccttaagttatttttt 47532993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University