View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17063_high_109 (Length: 234)

Name: NF17063_high_109
Description: NF17063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17063_high_109
NF17063_high_109
[»] chr8 (1 HSPs)
chr8 (144-187)||(38546320-38546363)


Alignment Details
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 144 - 187
Target Start/End: Complemental strand, 38546363 - 38546320
Alignment:
Q  144 aacgccgttgttccttgcttaattagttaatgcatataactttt 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  38546363 aacgccgttgttccttgcttaattagttaatgcatataactttt 38546320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University