View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17061_low_53 (Length: 231)

Name: NF17061_low_53
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17061_low_53
NF17061_low_53
[»] chr2 (1 HSPs)
chr2 (1-229)||(4779855-4780087)


Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 4779855 - 4780087
Alignment:
Q  1 tcatcagccaaataccaagattgctcnnnnnnn-ctacgtcacaattttaggactgtttttgcaatagatatccacataactgaatggaa--tgtagaca 97  Q
    ||||||||||||||||||||||||||        |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||  ||| ||||    
T  4779855 tcatcagccaaataccaagattgctcaaaaaaaactacgtcacaatgttaggactgtttttgcaataaatatccacataactgaatggaaaatgttgaca 4779954  T
Q  98 ttttgaataactgaaaggatgacannnnnnnn-aatcatgcatgggagaatgaaagaagaatatttctttttgttattcaaatttggtctgagataagta 196  Q
    ||||||||||| ||||||||||||         |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4779955 ttttgaataaccgaaaggatgacatttttttttaatcatgcatgggacaatgaaagaagaatatttctttttgttattcaaatttggtctgagataagta 4780054  T
Q  197 aagaataatcaataattattttatttagaaatc 229  Q
    |||||||||||||||||||||||||||||||||    
T  4780055 aagaataatcaataattattttatttagaaatc 4780087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University