View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17061_high_49 (Length: 236)

Name: NF17061_high_49
Description: NF17061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17061_high_49
NF17061_high_49
[»] chr5 (2 HSPs)
chr5 (17-114)||(2176453-2176550)
chr5 (179-214)||(2176353-2176388)


Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 2176550 - 2176453
Alignment:
Q  17 cagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacatnnnnnnntgactgataatttgtattttcaacatctaact 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||| ||||||||||||||||    
T  2176550 cagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacataaaaaaatgactgataatttgtcttttcaacatctaact 2176453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 179 - 214
Target Start/End: Complemental strand, 2176388 - 2176353
Alignment:
Q  179 gttttacttctaagaacaatttattcgagtcaatca 214  Q
    ||||||||||||||||||||||||||||||||||||    
T  2176388 gttttacttctaagaacaatttattcgagtcaatca 2176353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University