View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17060_low_25 (Length: 208)

Name: NF17060_low_25
Description: NF17060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17060_low_25
NF17060_low_25
[»] chr4 (1 HSPs)
chr4 (63-150)||(49880353-49880442)


Alignment Details
Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 63 - 150
Target Start/End: Complemental strand, 49880442 - 49880353
Alignment:
Q  63 ctcagtttctttacgacttgcactcaaatttcagtacatcaaacac--atacaaggactgaaaatatataaagtcccatatgatatagct 150  Q
    ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||    
T  49880442 ctcagtttctttacgacttgcactcaaatttcagtacatcaaacacatatacaaggactgaaaatatataaagtcccatatgatatagct 49880353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University