View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1705_low_99 (Length: 249)

Name: NF1705_low_99
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1705_low_99
NF1705_low_99
[»] chr5 (1 HSPs)
chr5 (53-249)||(16591048-16591237)


Alignment Details
Target: chr5 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 53 - 249
Target Start/End: Complemental strand, 16591237 - 16591048
Alignment:
Q  53 tatccctagcaatagggacatcatttgtattgggcatgacaaattgtgtccgtgttannnnnnnnnnnnnnnnnnnnnngaaggatctaaaatgaaaaaa 152  Q
    |||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||                      ||||||||||||||||||| |    
T  16591237 tatccctagcaatagggatatcatttgtatcgggcatgataaattgtgtccgtgttatttttatcctttttcattttttgaaggatctaaaatgaaaaga 16591138  T
Q  153 tgacataaagttatatttttaatagattttggacggataaaggcttggatcaaaatatatctattcagattttgatatcactcaatcaaacttaaaa 249  Q
     |||||||||||||||||||||||||| ||||| ||       ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||    
T  16591137 cgacataaagttatatttttaatagatcttggatgg-------cttggatcaaaatctatctatccagattttgatatcactcaatcaaacttaaaa 16591048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University