View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1705_low_82 (Length: 272)

Name: NF1705_low_82
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1705_low_82
NF1705_low_82
[»] chr1 (1 HSPs)
chr1 (70-266)||(40159378-40159574)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 70 - 266
Target Start/End: Original strand, 40159378 - 40159574
Alignment:
Q  70 tacctggttgggttgcgatgatggtgaaggaattagcgtcactcacatgctgctgtgtaagagtgtgaaatgtgttttcgtctttcgcagtgggttttgg 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40159378 tacctggttgggttgcgatgatggtgaaggaattagcgtcactcacatgctgctgtgtaagagtgtgaaatgtgttttcgtctttcgcagtgggttttgg 40159477  T
Q  170 gtttttgggtattacaagggttagggggtgcggctgatggtggtattgggtttttattaggcgctaacttttttgcttgcttccgtgcctttgcttc 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  40159478 gtttttgggtattacaagggttagggggtgcggctgatggtggtattgggtttttattaggcgctaacttttttgcttgcttccgtgccgttgcttc 40159574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University