View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1705_low_73 (Length: 292)

Name: NF1705_low_73
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1705_low_73
NF1705_low_73
[»] chr8 (1 HSPs)
chr8 (47-276)||(9051231-9051460)


Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 47 - 276
Target Start/End: Original strand, 9051231 - 9051460
Alignment:
Q  47 cgcataaccaaacacaagcaattttcttagctaattggctttgacaatgtcacagatttggagaaatggcaggacatcatcaattggaaatgaagatgaa 146  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9051231 cgcataaccaaacacgagcaattttcttagctaattggctttgacaaagtcacagatttggagaaatggcaggacatcatcaattggaaatgaagatgaa 9051330  T
Q  147 cttgaagagagaccaaaatggctagatagatggatggctacaaaaccgtgggagaatagaggaagggcttcaaccgatcaaagagactctattaagactg 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  9051331 cttgaagagagaccaaaatggctagatagatggatggctacaaaaccgtgggagaataggggaagggcttcaaccgatcaaagagactctattaagactg 9051430  T
Q  247 tggaagtcgacacatctcaaccttattcat 276  Q
    ||||||||||||||||||||||||||||||    
T  9051431 tggaagtcgacacatctcaaccttattcat 9051460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University