View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1705_low_135 (Length: 213)

Name: NF1705_low_135
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1705_low_135
NF1705_low_135
[»] chr1 (1 HSPs)
chr1 (74-197)||(3681003-3681126)


Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 74 - 197
Target Start/End: Original strand, 3681003 - 3681126
Alignment:
Q  74 gtcaatgattaactccaatttactcacaaattacaaaggattccctcaccccatcccctcccctcccgtgcnnnnnnnctttcttttacaaacgcatccc 173  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||    
T  3681003 gtcaatgattaactccaatttactcacaaattacaaaggattccctcaccccatcccctcccctcccgtgctttttttctttcttttacaaacgcatccc 3681102  T
Q  174 ctcctagttctaatacgcataatg 197  Q
    ||||||||||||||||||||||||    
T  3681103 ctcctagttctaatacgcataatg 3681126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University