View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1705_low_100 (Length: 249)

Name: NF1705_low_100
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1705_low_100
NF1705_low_100
[»] chr5 (2 HSPs)
chr5 (155-246)||(12559159-12559251)
chr5 (19-88)||(12559023-12559092)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 155 - 246
Target Start/End: Original strand, 12559159 - 12559251
Alignment:
Q  155 ggaacacatacaagtttgaatttaggaaatt-gacgtcgttagtaattgatttagccatgtgaattggtgatttaagtggctgagggctgagg 246  Q
    ||||||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12559159 ggaacacatacaagtttgagtttaggaaatttgacgccgttagtaattgatttagccatgtgaattggtgatttaagtggctgagggctgagg 12559251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 12559023 - 12559092
Alignment:
Q  19 aaggaataacaattgtctacgtacgttaatcttagtttctgcatgttatcatagtttctgcttgttatat 88  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  12559023 aaggaataacaattgtctacttacgttaatcttagtttctgcatgttatcatagtttctgcttgttatat 12559092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University