View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1705_high_79 (Length: 264)

Name: NF1705_high_79
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1705_high_79
NF1705_high_79
[»] chr3 (1 HSPs)
chr3 (17-114)||(48441730-48441827)
[»] chr8 (1 HSPs)
chr8 (64-164)||(2403269-2403369)
[»] chr1 (1 HSPs)
chr1 (47-99)||(34126651-34126703)


Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 48441827 - 48441730
Alignment:
Q  17 atattggtggggatgtgcatgatttgtttgatgatggtggtagtgatcgacttcttgaattgaaagaattgtctcttgatgaattagacatataagct 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48441827 atattggtggggatgtgcatgatttgtttgatgatggtggtagtgatcgacttcttgaattgaaagaattgtctcttgatgaattagacatataagct 48441730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 64 - 164
Target Start/End: Complemental strand, 2403369 - 2403269
Alignment:
Q  64 cgacttcttgaattgaaagaattgtctcttgatgaattagacatataagctatgcttttccggatgatgagaacagggaaatgaagatgatacaactagt 163  Q
    ||||||||||||||| |||| |||||| ||| ||||||||||||| ||||||| |||||  |||||||||||| || || ||||| || |||||| ||||    
T  2403369 cgacttcttgaattggaagagttgtctgttggtgaattagacatagaagctatacttttttggatgatgagaatagagagatgaaaataatacaattagt 2403270  T
Q  164 a 164  Q
    |    
T  2403269 a 2403269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 47 - 99
Target Start/End: Complemental strand, 34126703 - 34126651
Alignment:
Q  47 atgatggtggtagtgatcgacttcttgaattgaaagaattgtctcttgatgaa 99  Q
    |||||| |||| ||||  ||||||||||||||||||| |||||||||| ||||    
T  34126703 atgatgatggtggtgagagacttcttgaattgaaagatttgtctcttggtgaa 34126651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University