View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1705_high_110 (Length: 234)

Name: NF1705_high_110
Description: NF1705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1705_high_110
NF1705_high_110
[»] chr4 (3 HSPs)
chr4 (1-51)||(55615855-55615905)
chr4 (1-51)||(55623159-55623209)
chr4 (192-221)||(55630290-55630319)


Alignment Details
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 55615905 - 55615855
Alignment:
Q  1 cgggaaagaggatttgatgctggtaattatttacttactgtttacctttgc 51  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  55615905 cgggaaagaggatttgatgctggtaattatttacttactgtttacctttgc 55615855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 55623209 - 55623159
Alignment:
Q  1 cgggaaagaggatttgatgctggtaattatttacttactgtttacctttgc 51  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  55623209 cgggaaagaggatttgatgctggtaattatttacttactgtttacctttgc 55623159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 192 - 221
Target Start/End: Complemental strand, 55630319 - 55630290
Alignment:
Q  192 attcaagtcatgggatttgtcttgatgttc 221  Q
    ||||||||||||||||||||||||||||||    
T  55630319 attcaagtcatgggatttgtcttgatgttc 55630290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University