View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17059_high_9 (Length: 326)

Name: NF17059_high_9
Description: NF17059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17059_high_9
NF17059_high_9
[»] chr1 (1 HSPs)
chr1 (18-306)||(45685361-45685649)


Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 18 - 306
Target Start/End: Complemental strand, 45685649 - 45685361
Alignment:
Q  18 cctgtctctggctgtgcagtcagaagaagcactcttccaccgttggatcgtgctactgagcatatagcatcgacagtggagaagccacctggaccagcgg 117  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  45685649 cctgtctctggctgagcagtcagaagaagcactcttccaccgttggatcgtgctactgagcatatagcatcgacagtggagaagccgcctggaccagcgg 45685550  T
Q  118 aggcaatgaggagatcattggtggtgattggaggagtggtcatgtcgaagactaggtgggctgagaggcccagatgggctaagcgcatgcagaaggcttt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45685549 aggcaatgaggagatcattggtggtgattggaggagtggtcatgtcgaagactaggtgggctgagaggcccagatgggctaagcgcatgcagaaggcttt 45685450  T
Q  218 gagcattaggccttcgcggccaacaccgtagaggaaaacgcggccgttttgagaggagatggtggagagttcggttagtaagaggtcaa 306  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45685449 gagcattaggccttcgcggccaacaccgtagaggaaaacgcggccgttttgagaggagatggtggagagttcggttagtaagaggtcaa 45685361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University