View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17050_low_23 (Length: 229)

Name: NF17050_low_23
Description: NF17050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17050_low_23
NF17050_low_23
[»] chr5 (2 HSPs)
chr5 (14-204)||(33581007-33581197)
chr5 (14-204)||(32356315-32356505)
[»] chr6 (3 HSPs)
chr6 (14-173)||(17922281-17922440)
chr6 (14-169)||(17956035-17956190)
chr6 (14-106)||(17969494-17969586)
[»] chr4 (2 HSPs)
chr4 (86-173)||(8024603-8024690)
chr4 (29-89)||(8024847-8024907)


Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 33581197 - 33581007
Alignment:
Q  14 ttttgttgaaggatttcaacgaagttgtggtcttgcaacttcaactcacagcttgcaaatgctttgtcaattgaaggagactaccggggttcagtctccg 113  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||    
T  33581197 ttttgttgaaggatttcaacgaagttgtggtcttgtaacttcaactcacagcttgcaaaggctttgtcaattgaaggagactaccgaggttaagtctccg 33581098  T
Q  114 ccttagaatgtggatatgcctgtgctgctgaagtacactacccagatttgcaggttagttttgaaaggttacaagaaaagacatctccttt 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  33581097 ccttagaatgtggatatgcctgtgctgctgaagtacactacccagatttgcaggttagttttgaaaggtttcaagaaaagacatctccttt 33581007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 32356505 - 32356315
Alignment:
Q  14 ttttgttgaaggatttcaacgaagttgtggtcttgcaacttcaactcacagcttgcaaatgctttgtcaattgaaggagactaccggggttcagtctccg 113  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  32356505 ttttattgaaggatttcaacaaagttgtggtcttgcaacttcaactcacagcttgcaaatgctttgtcaattgaaggagactaccggggttcaatctccg 32356406  T
Q  114 ccttagaatgtggatatgcctgtgctgctgaagtacactacccagatttgcaggttagttttgaaaggttacaagaaaagacatctccttt 204  Q
    |||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||||||  ||||||| ||||||||||||||||||||||    
T  32356405 ccttagaatgtggatatgcctgtgctactgaagtacgctacccagagttgcaggttagtagtgaaaggctacaagaaaagacatctccttt 32356315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 14 - 173
Target Start/End: Complemental strand, 17922440 - 17922281
Alignment:
Q  14 ttttgttgaaggatttcaacgaagttgtggtcttgcaacttcaactcacagcttgcaaatgctttgtcaattgaaggagactaccggggttcagtctccg 113  Q
    ||||||| |||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |    
T  17922440 ttttgttaaaggttttcaatgaagttgtggtcttgcaacttcaactcacagcttgcaaatgctctgtcaactgaaggagactaccggggttcagtctcgg 17922341  T
Q  114 ccttagaatgtggatatgcctgtgctgctgaagtacactacccagatttgcaggttagtt 173  Q
    || ||||| ||||||||| |||||||  | |||||| |||||||||  ||||||||||||    
T  17922340 ccatagaacgtggatatgtctgtgctagtaaagtaccctacccagagatgcaggttagtt 17922281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 14 - 169
Target Start/End: Complemental strand, 17956190 - 17956035
Alignment:
Q  14 ttttgttgaaggatttcaacgaagttgtggtcttgcaacttcaactcacagcttgcaaatgctttgtcaattgaaggagactaccggggttcagtctccg 113  Q
    ||||||| | || |||||||||||| | |||| || ||| |||||||  |||||||||| ||||| |||| ||||||||  |||| | ||||| |||||     
T  17956190 ttttgttaacggttttcaacgaagtggaggtcatgtaacatcaactccaagcttgcaaaagctttttcaaatgaaggagggtacccgagttcactctccc 17956091  T
Q  114 ccttagaatgtggatatgcctgtgctgctgaagtacactacccagatttgcaggtt 169  Q
     ||||||| || || ||  || |||| ||||||||| ||| ||||| |||| ||||    
T  17956090 tcttagaacgttgacataactatgctactgaagtacgctatccagagttgctggtt 17956035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 106
Target Start/End: Complemental strand, 17969586 - 17969494
Alignment:
Q  14 ttttgttgaaggatttcaacgaagttgtggtcttgcaacttcaactcacagcttgcaaatgctttgtcaattgaaggagactaccggggttca 106  Q
    ||||||| |||| ||||||| ||||| || ||||||||| |||||| ||| | |||||||||||  |||  |||  ||||||||| |||||||    
T  17969586 ttttgttaaaggttttcaacaaagttttgttcttgcaacctcaacttacaacatgcaaatgcttcttcagctgattgagactacccgggttca 17969494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 86 - 173
Target Start/End: Complemental strand, 8024690 - 8024603
Alignment:
Q  86 gaaggagactaccggggttcagtctccgccttagaatgtggatatgcctgtgctgctgaagtacactacccagatttgcaggttagtt 173  Q
    ||||||||||||| |||||||||||| ||||||||| ||||||||| ||||||| || |||||| ||||||||| |||||||||||||    
T  8024690 gaaggagactaccagggttcagtctcggccttagaacgtggatatgtctgtgctactaaagtaccctacccagagttgcaggttagtt 8024603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 29 - 89
Target Start/End: Complemental strand, 8024907 - 8024847
Alignment:
Q  29 tcaacgaagttgtggtcttgcaacttcaactcacagcttgcaaatgctttgtcaattgaag 89  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||||    
T  8024907 tcaacgaagttgtggtcttgcaacttcaacttacagcttgcaaatgctttggcaactgaag 8024847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University