View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17050_low_14 (Length: 324)

Name: NF17050_low_14
Description: NF17050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17050_low_14
NF17050_low_14
[»] chr3 (1 HSPs)
chr3 (144-312)||(49221877-49222045)


Alignment Details
Target: chr3 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 144 - 312
Target Start/End: Complemental strand, 49222045 - 49221877
Alignment:
Q  144 caatttgtcgcttttgaacacttgggtttaggttgtagaataggtagttgtgttgagatacggtcttgtgctggcatgttggnnnnnnnaacatctcaaa 243  Q
    ||||||||||  |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||    
T  49222045 caatttgtcgtgtttgaacacttgagtttaggttgtagaataggtagttgtgttgagatacggtcttgtgctggcatgttggtttttttaacatctcaaa 49221946  T
Q  244 aaccatttttgttgaatttaaatatttttattcctgtagtgttttcttgtttctctccctggcccattc 312  Q
    ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |||||||    
T  49221945 aaccatttttgttgaatttaaattttttgattcctgtagtgttttcttgtttctctccctgacccattc 49221877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University