View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1704_low_54 (Length: 208)

Name: NF1704_low_54
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1704_low_54
NF1704_low_54
[»] chr8 (1 HSPs)
chr8 (1-148)||(39890308-39890455)


Alignment Details
Target: chr8 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 39890308 - 39890455
Alignment:
Q  1 aaacgacacattttcatggcaatcgactatctaaaaagagaaaacatgtaacnnnnnnnctttctatttcagacaagtagttgggagggatcgagacgaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||    
T  39890308 aaacgacacattttcatggcaatcgactatctaaaaagagaaaacatgtaactttttttctttctatttcagacaagtagttgggagggatcgagacgaa 39890407  T
Q  101 acgagcaacttttacaccccgtacatttctaaaaaattaaattagttt 148  Q
    || |||||||||| ||||||||||||||||||||||||||||||||||    
T  39890408 acaagcaacttttgcaccccgtacatttctaaaaaattaaattagttt 39890455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University