View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1704_low_43 (Length: 249)

Name: NF1704_low_43
Description: NF1704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1704_low_43
NF1704_low_43
[»] chr6 (1 HSPs)
chr6 (14-249)||(785915-786156)


Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 249
Target Start/End: Original strand, 785915 - 786156
Alignment:
Q  14 ttctactcaatgcctttgattttggtttctaatatatagacactattggtaaacctttgtaaccatgggatatgtttatgattgatttctttgaggc--- 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
T  785915 ttctactcaatgcctttgattttggtttctaatatatagacactattggtaaacctttgtaaccatgggatatgtttatgattgatttctttgaggcttt 786014  T
Q  111 ---aaaagttttggatttggtagagatggaaaaggaaatggttggcttcacttttggtttgtgtatgcatttgggcaaagatttagccactttcggcaaa 207  Q
       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  786015 ggcaaaagttttggatttggtagagatggaaaaggaaatggttggcttcacttttggtttgtgtatgcatttgggcaaagatttagccactttcggcaaa 786114  T
Q  208 acaaagtataggaggaagtgtgcaagcatggctaaagaaaac 249  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  786115 acaaagtataggaggaagtgtgcaagcatggctaaagaaaac 786156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University