View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17049_high_24 (Length: 237)

Name: NF17049_high_24
Description: NF17049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17049_high_24
NF17049_high_24
[»] chr7 (2 HSPs)
chr7 (112-221)||(40648824-40648933)
chr7 (1-42)||(40649050-40649091)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 112 - 221
Target Start/End: Complemental strand, 40648933 - 40648824
Alignment:
Q  112 ttggttataaatctgaaagccnnnnnnnagtttcattgaagtaagagttacaaatatacaactatgcgacatgttttagatatatgtgtgtgtttatgaa 211  Q
    |||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40648933 ttggttataaatctgaaagcctttttttagtttcattgaagtaagagttacaaatatacaactatgcgacatgttttagatatatgtgtgtgtttatgaa 40648834  T
Q  212 caatacatct 221  Q
    ||||||||||    
T  40648833 caatacatct 40648824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 40649091 - 40649050
Alignment:
Q  1 atgtagtaagaattttctccattgcacaaaagaaatctagaa 42  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  40649091 atgtagtaagaattttctccattgcacaaaagaaatctagaa 40649050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University