View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17047_low_18 (Length: 256)

Name: NF17047_low_18
Description: NF17047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17047_low_18
NF17047_low_18
[»] chr7 (2 HSPs)
chr7 (10-149)||(45039480-45039622)
chr7 (200-241)||(45039388-45039429)


Alignment Details
Target: chr7 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 10 - 149
Target Start/End: Complemental strand, 45039622 - 45039480
Alignment:
Q  10 aagaatatgaaaacttccttttgttgttctctgtctggaaatgtttttatttttattga----aatgtgattgcaaagacttggtagtctatgcnnnnnn 105  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||          
T  45039622 aagaaaatgaaaacttccttttgttgttctctgtctggaaatgtttttatttttattgaaattaatgtgattgcaaagacttggtagtctatgcaaaaaa 45039523  T
Q  106 ntttatcagaactgatcctatttattttactatttcttgacaag 149  Q
      ||||||||||||||||||||||||||||||||||||||||||    
T  45039522 a-ttatcagaactgatcctatttattttactatttcttgacaag 45039480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 200 - 241
Target Start/End: Complemental strand, 45039429 - 45039388
Alignment:
Q  200 cctgagagttgaggttatatatggccaacttagcatggttac 241  Q
    ||||||||||||||||||||||||||| ||||||||||||||    
T  45039429 cctgagagttgaggttatatatggccaccttagcatggttac 45039388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University