View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17045_low_18 (Length: 206)

Name: NF17045_low_18
Description: NF17045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17045_low_18
NF17045_low_18
[»] scaffold0356 (1 HSPs)
scaffold0356 (25-194)||(11414-11583)
[»] chr8 (1 HSPs)
chr8 (43-194)||(19739746-19739897)
[»] scaffold0075 (1 HSPs)
scaffold0075 (32-102)||(48730-48800)
[»] chr6 (1 HSPs)
chr6 (31-89)||(15144206-15144264)
[»] chr4 (1 HSPs)
chr4 (32-102)||(9007-9077)
[»] chr1 (1 HSPs)
chr1 (64-96)||(8636213-8636245)


Alignment Details
Target: scaffold0356 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: scaffold0356
Description:

Target: scaffold0356; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 25 - 194
Target Start/End: Original strand, 11414 - 11583
Alignment:
Q  25 tgttcgcgtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggctctttccatggctgcgactgatg 124  Q
    ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |    
T  11414 tgttcgcatggtgttcgccaaggagacccattgtcaccgcttcttttttgtctagttgaagaggttcttagtcgggcgctttccatggctgcgactgacg 11513  T
Q  125 gacacctcattccattgtcctattgctgtggagtctctttccccactcatattttatacgctgatgatgt 194  Q
    |||| ||||||||| ||||||||||  ||||||| |||||||||||||||||||||||||||||||||||    
T  11514 gacaactcattccaatgtcctattgtcgtggagtatctttccccactcatattttatacgctgatgatgt 11583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 43 - 194
Target Start/End: Original strand, 19739746 - 19739897
Alignment:
Q  43 caaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggctctttccatggctgcgactgatggacacctcattccattgt 142  Q
    |||||| |||||||||| || ||||| || ||||| ||||||||||||||||||||||| || ||||| ||| | |||   ||||  ||||  ||| |||    
T  19739746 caaggacacccattgtcccctcttctcttctgtctggctgaagaggttcttagtcgggcactctccattgcttcaactttcggacgactcacaccaatgt 19739845  T
Q  143 cctattgctgtggagtctctttccccactcatattttatacgctgatgatgt 194  Q
    | |||||  |||| |||||| | |||||||| |||||||||||||| |||||    
T  19739846 cttattgtcgtggggtctctcttcccactcagattttatacgctgacgatgt 19739897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0075 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0075
Description:

Target: scaffold0075; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 102
Target Start/End: Complemental strand, 48800 - 48730
Alignment:
Q  32 gtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggct 102  Q
    |||||||| | ||||| ||||| ||||| || |||||||| ||||||||||||||||| || || ||||||    
T  48800 gtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggtgctaagccgggct 48730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 89
Target Start/End: Complemental strand, 15144264 - 15144206
Alignment:
Q  31 cgtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggt 89  Q
    ||||||||| | ||||| ||||| ||||| || |||||||| |||||||||||||||||    
T  15144264 cgtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggt 15144206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 102
Target Start/End: Complemental strand, 9077 - 9007
Alignment:
Q  32 gtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggct 102  Q
    |||||||| | ||||| ||||| ||||| || |||||||| ||||||||||||||||| || || ||||||    
T  9077 gtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggtgctaagccgggct 9007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 96
Target Start/End: Complemental strand, 8636245 - 8636213
Alignment:
Q  64 cttcttttttgtctagctgaagaggttcttagt 96  Q
    |||||||||||| ||||||||||||||||||||    
T  8636245 cttcttttttgtttagctgaagaggttcttagt 8636213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University