View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17044_low_11 (Length: 269)

Name: NF17044_low_11
Description: NF17044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17044_low_11
NF17044_low_11
[»] chr1 (2 HSPs)
chr1 (22-142)||(17563884-17564010)
chr1 (163-227)||(17562247-17562312)
[»] chr7 (1 HSPs)
chr7 (84-141)||(29872028-29872085)


Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 22 - 142
Target Start/End: Complemental strand, 17564010 - 17563884
Alignment:
Q  22 taaactttaagaaagtggatcacttttgggagttatt------taaagtaactttttcaggacatttattgaaagcttaattcctattttttgaaagtaa 115  Q
    |||||||||||||||||||||||||||||||||||||      || |  |||||||||| ||||||||||||||||||| ||||||||||||||||||||    
T  17564010 taaactttaagaaagtggatcacttttgggagttattagctgatacacaaactttttcaagacatttattgaaagcttagttcctattttttgaaagtaa 17563911  T
Q  116 gttcttcttccacggtttacttgtttt 142  Q
    |||| ||||||||||||||||||||||    
T  17563910 gttcctcttccacggtttacttgtttt 17563884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 163 - 227
Target Start/End: Complemental strand, 17562312 - 17562247
Alignment:
Q  163 ggatgagtgatcaccaacacaa-ggcatgattgcctctagcaatatggcttgctaccaaaatgtta 227  Q
    ||||||||||||||| | |||| ||||||||||||||||||||||||| ||| |||||||||||||    
T  17562312 ggatgagtgatcaccgatacaaaggcatgattgcctctagcaatatggattgttaccaaaatgtta 17562247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 84 - 141
Target Start/End: Original strand, 29872028 - 29872085
Alignment:
Q  84 ttgaaagcttaattcctattttttgaaagtaagttcttcttccacggtttacttgttt 141  Q
    ||||||| ||| || | ||||||||||||||||||| ||| ||| |||||||||||||    
T  29872028 ttgaaagtttagtttcaattttttgaaagtaagttcctctcccatggtttacttgttt 29872085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University