View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17043_low_36 (Length: 225)

Name: NF17043_low_36
Description: NF17043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17043_low_36
NF17043_low_36
[»] chr3 (1 HSPs)
chr3 (25-206)||(9455241-9455423)


Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 25 - 206
Target Start/End: Original strand, 9455241 - 9455423
Alignment:
Q  25 aaattttgacccgtattatgcagcaaaatatcaaactaatcagcaaattaagtaactgaaagaatagatggcaaattaatt-aacaagatagagattata 123  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  9455241 aaattttgacccgtattatgtagcaaaatatcaaactaatcagcaaattaagtaactgaaagaatagatggcaaattaatttaacaagatagagattata 9455340  T
Q  124 ggtcacagagtagtgaaaaaattgtttctagtaatagctagttttatccaacacatatcaaagaaaatgataactattaaaga 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9455341 ggtcacagagtagtgaaaaaattgtttctagtaatagctagttttatccaacacatatcaaagaaaatgataactattaaaga 9455423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University