View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17043_low_34 (Length: 244)

Name: NF17043_low_34
Description: NF17043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17043_low_34
NF17043_low_34
[»] chr4 (3 HSPs)
chr4 (154-244)||(49290338-49290433)
chr4 (163-244)||(49297289-49297375)
chr4 (19-59)||(49290526-49290566)


Alignment Details
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 154 - 244
Target Start/End: Complemental strand, 49290433 - 49290338
Alignment:
Q  154 attaattcaaaaaatgtagtaactcgtggaactatgtagtatt-----taatttattatcaatacttataaaaaagataacattacatttaaccct 244  Q
    |||||||||||||||||||||||| ||||||| ||||||||||     ||||||||||||||||||||||||||||||||||||||||||||||||    
T  49290433 attaattcaaaaaatgtagtaacttgtggaaccatgtagtattccctttaatttattatcaatacttataaaaaagataacattacatttaaccct 49290338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 163 - 244
Target Start/End: Complemental strand, 49297375 - 49297289
Alignment:
Q  163 aaaaatgtagtaactcgtggaactatgtagtatt-----taatttattatcaatacttataaaaaagataacattacatttaaccct 244  Q
    ||||| ||||||||| ||||||| ||||||||||     ||||||||||||||||||||||||||||||||||||||||||||||||    
T  49297375 aaaaaggtagtaacttgtggaaccatgtagtattccctttaatttattatcaatacttataaaaaagataacattacatttaaccct 49297289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 49290566 - 49290526
Alignment:
Q  19 aaggtggactaaatatttaggttaatttaattcgatataac 59  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  49290566 aaggtggactaaatatttaggttaatttaattcgatataac 49290526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University