View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17042_low_7 (Length: 235)

Name: NF17042_low_7
Description: NF17042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17042_low_7
NF17042_low_7
[»] chr5 (1 HSPs)
chr5 (15-220)||(34150394-34150599)
[»] chr3 (1 HSPs)
chr3 (143-220)||(30422277-30422354)


Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 34150394 - 34150599
Alignment:
Q  15 gatgaagcaaaagtgatatatcgtgactttaaaacttcaaatatattgctcgacacagtaagtatactctcactgctcttacaactcaattgtcaactgg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34150394 gatgaagcaaaagtgatatatcgtgactttaaaacttcaaatatattgctcgacacagtaagtatactctcactgctcttacaactcaattgtcaactgg 34150493  T
Q  115 gcttttctgacactctgttttgtcaatgacagaattataatgcaaaactttccgattttggattggctaaggatggaccggcaggtgataatagtcatgt 214  Q
    |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34150494 gcttttctgacattccgttttgtcaatgacagaattataatgcaaaactttccgattttggattggctaaggatggaccggcaggtgataatagtcatgt 34150593  T
Q  215 ctctac 220  Q
    ||||||    
T  34150594 ctctac 34150599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 143 - 220
Target Start/End: Original strand, 30422277 - 30422354
Alignment:
Q  143 acagaattataatgcaaaactttccgattttggattggctaaggatggaccggcaggtgataatagtcatgtctctac 220  Q
    |||||| ||||||||||| || || ||||||||  |||| || |||||||| | ||||| ||| ||||||||||||||    
T  30422277 acagaactataatgcaaagctctcagattttgggatggcaaaagatggaccagaaggtggtaagagtcatgtctctac 30422354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University