View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17041_low_28 (Length: 229)

Name: NF17041_low_28
Description: NF17041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17041_low_28
NF17041_low_28
[»] chr5 (1 HSPs)
chr5 (1-223)||(7499099-7499321)


Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 7499099 - 7499321
Alignment:
Q  1 ttggaaggggaaggaatggtaagagtggtatgtggaagcaacaatgatgacaaatgcaaaaacaagaggtttagagttcagcaaggagatgtttttgtgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7499099 ttggaaggggaaggaatggtaagagtggtatgtggaagcaacaatgatgacaaatgcaaaaacaagaggtttagagttcagcaaggagatgtttttgtgg 7499198  T
Q  101 tgcctaggtttcatccaatggctcaaatgtcatttgttaatcagacacttgtttttatgggattcagcactgctgcaaagaaaaatcatcctcagttttt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7499199 tgcctaggtttcatccaatggctcaaatgtcatttgttaatcagccacttgtttttatgggattcagcactgctgcaaagaaaaatcatcctcagttttt 7499298  T
Q  201 ggctggtaaagaatctgtgctgc 223  Q
    |||||||||||||||||||||||    
T  7499299 ggctggtaaagaatctgtgctgc 7499321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University