View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17036_low_12 (Length: 306)

Name: NF17036_low_12
Description: NF17036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17036_low_12
NF17036_low_12
[»] chr2 (2 HSPs)
chr2 (129-293)||(43178661-43178829)
chr2 (18-60)||(43176992-43177034)


Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 129 - 293
Target Start/End: Original strand, 43178661 - 43178829
Alignment:
Q  129 tgaggagaattgaagatcttgagatgagcacactccacttcaagttttcaaaccaacgccgtcagatcaaccaattggattgaaaaatacaag----tat 224  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||  | |||||||||| ||||||||||||||||||     ||    
T  43178661 tgaggagaattgaagatcttgagatgagcacactccactccaagttttcaaaccaacgccaccggatcaaccaagtggattgaaaaatacaaggattaat 43178760  T
Q  225 taatgtgggtgtattttttgtcgaaattgaaattttcaaagaaaattgtaaacgaccaaattgaatctt 293  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  43178761 taatgtggatgtattttttgtcgaaattgaaattttcaaagaaaattgtaaacgaccgaattgaatctt 43178829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 43176992 - 43177034
Alignment:
Q  18 cagtgaagaccgattcaattgagaatctcaatcattgaaatct 60  Q
    |||||||||||||||||||||||||||||||||||||| ||||    
T  43176992 cagtgaagaccgattcaattgagaatctcaatcattgatatct 43177034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University