View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17033_low_37 (Length: 212)

Name: NF17033_low_37
Description: NF17033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17033_low_37
NF17033_low_37
[»] chr7 (1 HSPs)
chr7 (1-212)||(47138466-47138667)


Alignment Details
Target: chr7 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 47138466 - 47138667
Alignment:
Q  1 ggaaggaaaccatgcgattttgagcttggtgcaatgcaatgcaatgattgaggaaaagaaaaaggaaaagaagtttagttttgtttgaataataatgatt 100  Q
    |||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47138466 ggaaggaaaccatgcgattttgagcttggtgca----------atgattgaggaaaagaaaaaggaaaagaagtttagttttgtttgaataataatgatt 47138555  T
Q  101 attacaaaagaggaagaggaagaggaagagnnnnnnnntcggagaaaaatggaagacaaaggattgaaaataaataacaaccgtgtaacgcgggaatcac 200  Q
    ||||||||||||||||||||||||||||||        ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  47138556 attacaaaagaggaagaggaagaggaagagaaaaaaaatcggagaaaaatggaagaccaaggattgaaaataaataacaaccgtgtaacgcgggaatcac 47138655  T
Q  201 acactcttttct 212  Q
    ||||||||||||    
T  47138656 acactcttttct 47138667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University