View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17033_low_27 (Length: 265)

Name: NF17033_low_27
Description: NF17033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17033_low_27
NF17033_low_27
[»] chr8 (1 HSPs)
chr8 (17-252)||(14853659-14853894)


Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 14853894 - 14853659
Alignment:
Q  17 gggagaagatccattgacgttacccatgaactctactgagatttgggtacaggtccatcaactgcctttcggttttatggacaaaactattggggagcta 116  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14853894 gggagaagatccattgacgttacccatgaactctactgaaatttgggtacaggtccatcaactgcctttcggttttatggacaaaactattggggagcta 14853795  T
Q  117 gtcggaagtcatattggcaaactagttaaatatgacgaggataacaactatggaccatggcggaaatacatgaggttacgggtggagattgcgttggagg 216  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14853794 gccggaagtcatattggcaaactagttaaatatgacgaggataacaactatggaccatggcggaaatacatgaggttacgggtggagattgcgttggagg 14853695  T
Q  217 aaccccttcaacaagatctagtcattgaaagaagtg 252  Q
    ||||||||||||||||||||||||||||||||||||    
T  14853694 aaccccttcaacaagatctagtcattgaaagaagtg 14853659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University