View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17030_low_27 (Length: 310)

Name: NF17030_low_27
Description: NF17030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17030_low_27
NF17030_low_27
[»] chr6 (4 HSPs)
chr6 (8-151)||(1694430-1694573)
chr6 (216-283)||(1694309-1694376)
chr6 (75-122)||(1684034-1684081)
chr6 (23-61)||(1684096-1684134)


Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 8 - 151
Target Start/End: Complemental strand, 1694573 - 1694430
Alignment:
Q  8 tgataagaatgatgttccagctgtgactgtagtctgatctgattatggcacttcnnnnnnnnnnnnncaaattagcatgatattacaaattttattagag 107  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||             ||||||||||||| |||||||||||||||||||    
T  1694573 tgataagaatgatgctccagctgtgactgtagtctgatctgattatggcacttcttttttcttttttcaaattagcatgacattacaaattttattagag 1694474  T
Q  108 gttttatctaggtgannnnnnnacaaatcaggatgacattacaa 151  Q
    | |||||||||||||       |||||| |||||||||||||||    
T  1694473 gatttatctaggtgatttttttacaaattaggatgacattacaa 1694430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 216 - 283
Target Start/End: Complemental strand, 1694376 - 1694309
Alignment:
Q  216 tactctcatattccaaggttttattgagaagaattggctattttttacctttcacaacctccatcatg 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  1694376 tactctcatattccaaggttttattgagaagaattggctattttttacctttcacaacctctatcatg 1694309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 75 - 122
Target Start/End: Complemental strand, 1684081 - 1684034
Alignment:
Q  75 caaattagcatgatattacaaattttattagaggttttatctaggtga 122  Q
    |||||||| |||| ||||||||||||||||||||||||||||||||||    
T  1684081 caaattaggatgacattacaaattttattagaggttttatctaggtga 1684034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 23 - 61
Target Start/End: Complemental strand, 1684134 - 1684096
Alignment:
Q  23 tccagctgtgactgtagtctgatctgattatggcacttc 61  Q
    ||||| |||||||| ||||||||||||||||||||||||    
T  1684134 tccagttgtgactgcagtctgatctgattatggcacttc 1684096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University