View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17025_low_38 (Length: 210)

Name: NF17025_low_38
Description: NF17025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17025_low_38
NF17025_low_38
[»] chr6 (1 HSPs)
chr6 (15-189)||(30761433-30761607)


Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 189
Target Start/End: Original strand, 30761433 - 30761607
Alignment:
Q  15 agaatattcggagctaaaattgacaagatatttatatattatgtgctaaacttgggtgcgaaatcccggacgcacagctaaaagtgctaagattgtttgt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30761433 agaatattcggagctaaaattgacaagatatttatatattatgtgctaaacttgggtgcgaaatcccggacgcacagctaaaagtgctaagattgtttgt 30761532  T
Q  115 taatgatgaaaactcttggcctaatctaagatcttagtatgttagcagttagacctttcgggattttagtttaag 189  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  30761533 taatgatgaaaactcttggactaatctaagatcttagtatgttagcagttagacctttcggggttttagtttaag 30761607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University