View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17025_high_14 (Length: 309)

Name: NF17025_high_14
Description: NF17025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17025_high_14
NF17025_high_14
[»] chr5 (1 HSPs)
chr5 (175-309)||(7499299-7499433)


Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 175 - 309
Target Start/End: Complemental strand, 7499433 - 7499299
Alignment:
Q  175 gcacaagaattacactcgaaaatgatcgaatcatccggtttctccaaaagcttgtcaatggttgtattgcttacacctaaagaggtagcaactatctctc 274  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7499433 gcacaagaattacactcgaaaatgatcgaatcatccggtttctccaaaagcttgtcaatggttgtattgcttacacctaaagaggtagcaactatctctc 7499334  T
Q  275 tgtctagaatttgcagcacagattctttaccagcc 309  Q
    |||||||||||||||||||||||||||||||||||    
T  7499333 tgtctagaatttgcagcacagattctttaccagcc 7499299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University