View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17024_low_8 (Length: 204)

Name: NF17024_low_8
Description: NF17024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17024_low_8
NF17024_low_8
[»] chr4 (1 HSPs)
chr4 (17-193)||(2608978-2609154)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 193
Target Start/End: Original strand, 2608978 - 2609154
Alignment:
Q  17 ggattgtgagcatagcaacatgatttttggtaattgcgaattggtaatgctaagaaccatggtgtagactcatgaggtttgtatttggttatgaaagttc 116  Q
    |||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  2608978 ggattgtgagcataacaacatgatttttggtaattgcgaattggtagtgctaagaaccatggtgtagactcatgaggtttgtatttggttatggaagttc 2609077  T
Q  117 cacatgtgtgccaattcttgcaagttgaccttgctcttgctaaggaatctggagagagaaaagaggagattgatgat 193  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||    
T  2609078 cacatgtgtgccaattcttgcaagttgatcttgctcttgctaaggaatctggagagagaaaagagaagatggatgat 2609154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University