View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1701_high_41 (Length: 224)

Name: NF1701_high_41
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1701_high_41
NF1701_high_41
[»] chr5 (1 HSPs)
chr5 (1-207)||(7837302-7837508)


Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 7837508 - 7837302
Alignment:
Q  1 gtgttggaagattaaggtgaccgttgttgttgctatgatgataattaggaacatgctgaaaatgttgttgaggaatactatgttgttgttggacatgttt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  7837508 gtgttggaagattaaggtgaccgttgttgttgctatgatgataattaggaacatgctgaacatgttgttgaggaatactatgttgttgttggacatgttt 7837409  T
Q  101 tcgatggaaattacggtgacaatcacaagcagcacatttgaagtattgtggggtaccttcttcaccgcttggcatgaattcaccacatccatctaccacg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7837408 tcgatggaaattacggtgacaatcacaagcagcacatttgaagtattgtggggtaccttcttcaccgcttggcatgaattcaccacatccatctaccacg 7837309  T
Q  201 tggcttc 207  Q
    |||||||    
T  7837308 tggcttc 7837302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University