View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1701_high_37 (Length: 233)

Name: NF1701_high_37
Description: NF1701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1701_high_37
NF1701_high_37
[»] chr4 (1 HSPs)
chr4 (18-233)||(38504285-38504500)


Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 38504285 - 38504500
Alignment:
Q  18 atttgtatttgctcaggttagtttaggacgttatctagtgtttctttcttgcaaactttgtggctttgagtatatccagcaacactcagattctctgcag 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38504285 atttgtatttgctcaggttagtttaggacgttatctagtgtttctttcttgcaaactttgtggctttgagtatatccagcaacactcagattctctgcag 38504384  T
Q  118 tcagggaatccacacagtcacgtagtcagcatgtaaggagttgttcgatcaaagatcagatggcttggatcgcttgatggaggatacccgacttcaggga 217  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38504385 tcagggaatccacacagtcacgtagtcagcatgtaaggaattgttcgatcaaagatcagatggcttggatcgcttgatggaggatacccgacttcaggga 38504484  T
Q  218 atccaattcccaagtt 233  Q
    ||||||||||||||||    
T  38504485 atccaattcccaagtt 38504500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University