View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17015_high_29 (Length: 210)

Name: NF17015_high_29
Description: NF17015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17015_high_29
NF17015_high_29
[»] chr1 (1 HSPs)
chr1 (19-100)||(10351553-10351638)


Alignment Details
Target: chr1 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 10351638 - 10351553
Alignment:
Q  19 gatggattctcaaaccattgacaaa----catttaaattagtgatattctcttccatgaaaatagataaagattttagtttattat 100  Q
    |||||||||||||||||||||||||    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  10351638 gatggattctcaaaccattgacaaattaacatttaaattagtgatattctcttcgatgaaaatagataaagattttagtttattat 10351553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University