View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17010_low_13 (Length: 252)

Name: NF17010_low_13
Description: NF17010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17010_low_13
NF17010_low_13
[»] chr7 (1 HSPs)
chr7 (18-172)||(31944749-31944903)
[»] chr2 (1 HSPs)
chr2 (112-164)||(31776046-31776098)


Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 18 - 172
Target Start/End: Original strand, 31944749 - 31944903
Alignment:
Q  18 accttggagtttggttggataacggcggtatggtccttgtaggtagcatttccatatggtgaacactctgatacctcagagtttgtgtgccccaagacac 117  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||    
T  31944749 accttggagtttggttggataccggcggtatggtccttgtaggtagcatttccatatggtgaacactctgttacctcagagtttgtgtgccccgagacac 31944848  T
Q  118 tagttaagaaaaccaacatagaatgattgtattggaaattgtggaaatatgagta 172  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  31944849 tagttaagaaaaccaacataaaatgattgtattggaaattgtggaaatatgagta 31944903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 112 - 164
Target Start/End: Complemental strand, 31776098 - 31776046
Alignment:
Q  112 agacactagttaagaaaaccaacatagaatgattgtattggaaattgtggaaa 164  Q
    ||||||||||||||||||| || |||||| |||||||||| ||||||| ||||    
T  31776098 agacactagttaagaaaactaatatagaaagattgtattgaaaattgtagaaa 31776046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University