View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17010_low_12 (Length: 255)

Name: NF17010_low_12
Description: NF17010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17010_low_12
NF17010_low_12
[»] chr7 (1 HSPs)
chr7 (17-233)||(41704886-41705102)


Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 233
Target Start/End: Original strand, 41704886 - 41705102
Alignment:
Q  17 caaaggtgcaacaagggtgaagaccacttgcacactcaagtgctcgatttgtgtcaacatgacctgaattttccaagtaacggtgacaaatactagagga 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  41704886 caaaggtgcaacaagggtgaagaccacttgcacactcaagtgctcgatttgtgtcaacttgacctgaattttccaagtaacggtgacaaatactagagga 41704985  T
Q  117 agagcagttaagaggagaaaccaagagacgaggggaacagttgaaaatgaacactgtgttggatgaagttatgttgaaaggaagtgactgatttaaccaa 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41704986 agagcagttaagaggagaaaccaagagacgaggggaacagttgaaaatgaacactgtgttggatgaagttatgttgaaaggaagtgactgatttaaccaa 41705085  T
Q  217 ataccattgcttaccgg 233  Q
    |||||||||||||||||    
T  41705086 ataccattgcttaccgg 41705102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University