View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1700_low_18 (Length: 321)

Name: NF1700_low_18
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1700_low_18
NF1700_low_18
[»] chr5 (1 HSPs)
chr5 (19-80)||(31701899-31701960)
[»] chr8 (1 HSPs)
chr8 (30-137)||(17719868-17719974)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 31701960 - 31701899
Alignment:
Q  19 gtttcacatgatccttgccatatctctatcatatgttcgaatagcctcttcaaaattttcat 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31701960 gtttcacatgatccttgccatatctctatcatatgttcgaatagcctcttcaaaattttcat 31701899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 137
Target Start/End: Complemental strand, 17719974 - 17719868
Alignment:
Q  30 tccttgccatatctctatcatatgttcgaatagcctcttcaaaattttcatataaacgatttttgaaggagcaaaaactgattaatttgacaataataca 129  Q
    |||||||||| |||||| |||||| || ||||||||| |||||||| |||   || ||||||||||  | ||||||| ||||||||||||||| ||||||    
T  17719974 tccttgccatgtctctaacatatgctccaatagcctcatcaaaattctcacg-aatcgatttttgacagcgcaaaaattgattaatttgacaaaaataca 17719876  T
Q  130 taaattga 137  Q
    ||||||||    
T  17719875 taaattga 17719868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University