View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17002_high_39 (Length: 202)

Name: NF17002_high_39
Description: NF17002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17002_high_39
NF17002_high_39
[»] chr1 (1 HSPs)
chr1 (54-188)||(23945252-23945386)


Alignment Details
Target: chr1 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 54 - 188
Target Start/End: Complemental strand, 23945386 - 23945252
Alignment:
Q  54 tactttaatgctagcattagaagagttaatttgggagggtttgtacccgctcctattttcatgcatatgatcgtatttttcagcattcaattcattaatt 153  Q
    |||||||||||| |||||||||||||||||||||||||||||||| ||||||||  ||||||||||||||||||||||||||||||||||||||||||||    
T  23945386 tactttaatgcttgcattagaagagttaatttgggagggtttgtaaccgctccttatttcatgcatatgatcgtatttttcagcattcaattcattaatt 23945287  T
Q  154 cttttcttaagattttgaaatgatgtacctttcat 188  Q
    |||||||||||||||||||||||||||||||||||    
T  23945286 cttttcttaagattttgaaatgatgtacctttcat 23945252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University