View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17001_low_12 (Length: 323)

Name: NF17001_low_12
Description: NF17001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17001_low_12
NF17001_low_12
[»] chr3 (1 HSPs)
chr3 (38-317)||(46499738-46500004)


Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 38 - 317
Target Start/End: Original strand, 46499738 - 46500004
Alignment:
Q  38 tggtttttggtcgtctgcatcattcactcaccaggtttgtggtggtgccggtgcgcagcgactcgtggtggttttcggggaccctcttggatggatggtt 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46499738 tggtttttggtcgtctgcatcattcactcaccaggtttgtggtggtgccggtgcgcagcgactcgtggtggttttcggggaccctcttggatggatggtt 46499837  T
Q  138 cacaggggtagatctagattcagatctctcagtgactggttctccgtcctccatcactgttcgggttttgctttttcggtggcggcattgggtggtgttg 237  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||             ||||||||||    
T  46499838 cacaggggtagatctagattcagatctctcagtggctggttctccgtcctccatcactgttcgggttttgctttttc-------------ggtggtgttg 46499924  T
Q  238 gtaaattatgtctgatacgtatgcatgcatgctttataacgatgtttcaaaatggttcatgcctgaacttgtatattctt 317  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  46499925 gtaaattatgtctgattcgtatgcatgcatgctttataacgatgtttcaaaatggttcatgcctgaacttgtattttctt 46500004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University