View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17000_low_17 (Length: 201)

Name: NF17000_low_17
Description: NF17000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17000_low_17
NF17000_low_17
[»] chr3 (1 HSPs)
chr3 (59-201)||(42844254-42844396)
[»] chr8 (2 HSPs)
chr8 (132-198)||(12622847-12622913)
chr8 (132-198)||(12628773-12628839)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 59 - 201
Target Start/End: Complemental strand, 42844396 - 42844254
Alignment:
Q  59 gacacgactaagtgaaacctaagaagaccgccgctaacgcctgtaaatcattaaatgcttgaagaagttcataatatcgactcttatagtgctcaagtga 158  Q
    ||||||||| | || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42844396 gacacgactcaatgcaaccttagaagaccgccgctaacgcctgtaaatcattaaatgcttgaagaagttcataatatcgactcttatagtgctcaagtga 42844297  T
Q  159 ataacttagttgtctaattgcctccttcttctcctcagccaca 201  Q
    |||||||||||||||||||||||||||||||||||| ||||||    
T  42844296 ataacttagttgtctaattgcctccttcttctcctcggccaca 42844254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 132 - 198
Target Start/End: Complemental strand, 12622913 - 12622847
Alignment:
Q  132 atatcgactcttatagtgctcaagtgaataacttagttgtctaattgcctccttcttctcctcagcc 198  Q
    |||| ||||| |||| || ||||  ||| ||||||||||||||||||||||| ||||||||||||||    
T  12622913 atatagactcctataatgatcaacagaaaaacttagttgtctaattgcctccctcttctcctcagcc 12622847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 132 - 198
Target Start/End: Complemental strand, 12628839 - 12628773
Alignment:
Q  132 atatcgactcttatagtgctcaagtgaataacttagttgtctaattgcctccttcttctcctcagcc 198  Q
    |||||||||| |||||| |||||| ||| | | || |||||||||||||||| ||||||||||||||    
T  12628839 atatcgactcctatagtactcaagggaaaagcataattgtctaattgcctccctcttctcctcagcc 12628773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University