View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17000_low_15 (Length: 242)

Name: NF17000_low_15
Description: NF17000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17000_low_15
NF17000_low_15
[»] scaffold0011 (1 HSPs)
scaffold0011 (1-217)||(240235-240448)
[»] chr4 (1 HSPs)
chr4 (7-45)||(44599484-44599522)


Alignment Details
Target: scaffold0011 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 240448 - 240235
Alignment:
Q  1 cgcactcaatgataccacttttttaggttaatttctaaaacatctctataactaattacttggcatgttttgattagatgcaatataagcaagtaaaaat 100  Q
    |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||    
T  240448 cgcactcaatgataccacttttttgggttaatttctaaaatatctctataactaattacttggcatgttttgattagatgcaatataagtaagt-aaaat 240350  T
Q  101 agtcacataaaatatgccacacacatacnnnnnnncacccatatcaagtcaaatacacaagcatcctctaatatccaaggaccgtccttcttcatttgat 200  Q
    ||||||||  ||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  240349 agtcacat--aatatgccacacacatacaaaaaaacacccatatcaagtcaaatacacaagcatcctctaatatccaaggaccgtccttctccatttgat 240252  T
Q  201 gcaacatgattacatga 217  Q
    |||||||||||||||||    
T  240251 gcaacatgattacatga 240235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 45
Target Start/End: Original strand, 44599484 - 44599522
Alignment:
Q  7 caatgataccacttttttaggttaatttctaaaacatct 45  Q
    |||||||||||||| ||||||||||||||||||| ||||    
T  44599484 caatgataccacttctttaggttaatttctaaaatatct 44599522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University