View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1700-Insertion-3 (Length: 249)

Name: NF1700-Insertion-3
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1700-Insertion-3
NF1700-Insertion-3
[»] chr3 (2 HSPs)
chr3 (108-138)||(38346578-38346608)
chr3 (12-40)||(38346482-38346510)


Alignment Details
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 138
Target Start/End: Original strand, 38346578 - 38346608
Alignment:
Q  108 cttttagggatatttaactagagatccctta 138  Q
    |||||||||||||||||||||||||||||||    
T  38346578 cttttagggatatttaactagagatccctta 38346608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 40
Target Start/End: Original strand, 38346482 - 38346510
Alignment:
Q  12 tatggtttattgaaatttttgctttctgc 40  Q
    |||||||||||||||||||||||||||||    
T  38346482 tatggtttattgaaatttttgctttctgc 38346510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University