View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1700-Insertion-12 (Length: 143)

Name: NF1700-Insertion-12
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1700-Insertion-12
NF1700-Insertion-12
[»] chr4 (1 HSPs)
chr4 (8-143)||(21148074-21148209)


Alignment Details
Target: chr4 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 8 - 143
Target Start/End: Original strand, 21148074 - 21148209
Alignment:
Q  8 catagcattcaaattgttcttttatttgctttttctcctttcatatggagtatggcattgcttatcttcatatgctaattttatgacctttatatttacc 107  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||     
T  21148074 catagcattcaaattgttcttttatttactttttctcctttcatatggagtatggcattgcttatcttcatatgctaattttacgacctttttatttacg 21148173  T
Q  108 gattcgtgtcattgagagtgctacttgttctgatta 143  Q
    |||||||||||||||| |||||||||||||||||||    
T  21148174 gattcgtgtcattgagggtgctacttgttctgatta 21148209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University