View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16999_high_1 (Length: 238)

Name: NF16999_high_1
Description: NF16999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16999_high_1
NF16999_high_1
[»] chr5 (1 HSPs)
chr5 (1-220)||(4702209-4702428)
[»] chr6 (1 HSPs)
chr6 (105-153)||(11593478-11593526)


Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 4702428 - 4702209
Alignment:
Q  1 cctcgacatcgttaacaaaatcatcataattgacactaacagtatcttgagtgctaacccccctgttaatggtaaaattgaatgtttgcccctctttgag 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4702428 cctcgacatcattaacaaaatcatcataattgacactaacagtatcttgagtgctaacccccctgttaatggtaaaattgaatgtttgcccctctttgag 4702329  T
Q  101 taaaattggttgtgacacatccccacttctaacttcaggaccctgcaaataaaaattagttaataccacgcaatacctagcatgttacataaatacattt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  4702328 taaaattggttgtgacacatccccacttctaacttcaggaccctgcaaataaaaattagttaataccacgcaatacctagcatgttacatcaatacattt 4702229  T
Q  201 aactatcagtatcttagtgt 220  Q
    ||||||||||||||||||||    
T  4702228 aactatcagtatcttagtgt 4702209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 11593526 - 11593478
Alignment:
Q  105 attggttgtgacacatccccacttctaacttcaggaccctgcaaataaa 153  Q
    |||||||||| || |||||||||||||||||||||||||| ||| ||||    
T  11593526 attggttgtggcaaatccccacttctaacttcaggaccctacaattaaa 11593478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University